Excerpt for Epigenetics explained by Janine Schott, available in its entirety at Smashwords



Epigenetics

Janine Schott

ISBN: 978-1-4580-8340-1

Smashwords Edition published in 2011.

Copyright Janine Schott 2011.

Other titles by Janine Schott include:

~ The Epigenetics of Diet

Additional titles by Janine Schott are due for release at Smashwords.com in 2011.

This book or any portion of it may not be copied in any form or by any means without the express prior written permission of Janine Schott, except for genuine review purposes. Any other copying is a violation of copyright law and may result in civil and/or criminal penalties.

Smashwords Edition, License Notes

This eBook is licensed for your personal enjoyment only. This eBook may not be re-sold or given away to other people. If you would like to share this book with another person, please purchase an additional copy for each recipient. If you’re reading this book and did not purchase it or it was not purchased for your use only, then please return to Smashwords.com and purchase your own copy. Thank you for respecting the hard work of this author.

All products or company names are used for identification purposes only and may be trademarks of their respective owners.



Cover page figure: A young person shows a genetic switch is off. During her life, an event triggers the genetic switch on (older person represented with the cane). Of this person's offspring, most have the genetic switch on.

Cover page title: The “p” in Epigenetics ends in a DNA strand that is replicating.



* * *







I dedicate this book to Peter, my husband, my friend

and the love of my life.



* * *





Contents

Synopsis

About the Author

Chapter 1. Epigenetics

Glossary

References

A note from the author



* * *





Synopsis

This book is an excerpt of The Epigenetics of Diet eBook available at Smashwords.com. It comprises just the chapter titled Epigenetics.

The first half of the Epigenetics chapter is quite scientific in nature, however, it is essential in establishing the science behind the information detailed throughout the rest of The Epigenetics of Diet book. It is not intended to turn the reader into a scientist. It simply sets the scene for explanations detailed throughout The Epigenetics of Diet book. The second half of the chapter explains the amazing results of various studies in epigenetics.

The latest research shows that what we eat affects not only our hearts and bodies, but also our minds and even our children. This book provides the science behind The Epigenetics of Diet book's explanations of the links between existing research into our food, emotions, bodies and behaviour.



* * *





About the author

Janine Schott was born, raised and educated in Adelaide, South Australia. Throughout her diverse career she has worked all around Australia in the Information Technology and Education industries.

For 30 years, Janine was frustratingly plump. A serial monogamous dieter, Janine tried diet after diet, each with the same disappointing result. In 2001, a lengthy juggle of dieting and many minor ailments culminated in a battle with a persistent migraine (that lasted for weeks). Finding a solution to this migraine sparked a journey of unimaginable discovery which became the foundation of this book.

Obesity now rates in Australia as an epidemic. Some experts believe Australia is the fattest nation. Preventative medicine is Janine’s passion. The illnesses she repeatedly experienced are commonly treated individually by doctors. It is Janine’s aim to equip doctors with a simple interpretation of research on the effects of diet on people from the pre-agriculture age right through to the present. She knows that redefining “healthful foods” is a monumental challenge and is dedicated to this important cause as it will save lives. No drugs, no operations, no expensive programs ... just good old-fashioned truly nutritious foods.

Janine has settled in Brisbane, Australia, and is devoted wife to Peter and mother to two young cherished boys.



* * *





Chapter 1. Epigenetics

Epigenetics suggests that what your parents, grandparents and even great-grandparents experienced (including diet) can affect your well-being.”

~ Ken O’Brien[65]

Introduction

Genetics is the branch of biology pertaining to inheritance of characteristics among related organisms[84] (including people). Genes are strips of deoxyribonucleic acid (DNA) which are the basic units of inheritance after conception (Figure 1).[69] Classic genetics states that genes are unchanged and unchanging throughout one’s life. Our grandparents and parents pass on their genes unchanged to each of their descendants.

This is now, however, a concept that is being challenged.

Epigenetics can be regarded as a comparatively new branch of genetics, a long-established field of scientific endeavour. Epi is a prefix taken from the Greek that means “added on”, hence epigenetics means added onto the genes. In keeping with the themes of this book epigenetics may be defined as the study of heritable and reversible changes in genes induced by environmental entities, including nutritional factors. In layperson’s terms, this means that an experience can switch genes on or off and this modification is inherited by future offspring.

Figure 1: DNA

Epigenetics is revealing the hidden influences upon genes that could affect every aspect of our lives. People’s genes are shaped in part by their ancestors' life experiences. Epigenetics bridges the gap between nature and nurture.

A discussion of the biology of DNA is an essential prerequisite for understanding the concepts of epigenetics.

Biology of DNA

In the body DNA is located within the nucleus of different cells in association with particular proteins called histones. The DNA molecules exist in a helix or spiral configuration made up of two long lines or strands of component nucleic acids. The strands of DNA comprise the four nucleotide units of DNA[2], namely adenine (A), guanine (G), thymine (T) and cytosine (C) (Figure 2). The sequence of these AGTC units dictate the sequence of amino acids found in the protein encoded by the given gene.

Figure 2: The four bases of DNA

The sequence of a gene can be found in appropriate scientific databases. An example of a gene sequence[28] is shown in Figure 3.

Figure 3: Part of the gene sequence for part of the haemoglobin molecule

TACCACGACAGAGGACGGCTGTTCTGGTTGCAGTTCCGGCGGACCCCGTTCCAACCGCGCGTGCGACCGCTCATACCACGCCTCCGGG
ACCTCTCCTACAAGGACAGGAAGGGGTGGTGGTTCTGGATGAAGGGCGTGAAGCTGGACTCGGTGCCGAGACGGGTCCAATTCCCGGT
GCCGTTCTTCCACCGGCTGCGCGACTGGTTGCGGCACCGCGTGCACCTGCTGTACGGGTTGCGCGACAGGCGGGACTCGCTGGACGTG
CGCGTGTTCGAAGCCCACCTGGGCCAGTTGAAGTTCGAGGATTCGGTGACGGACGACCACTGGGACCGGCGGGTGGAGGGGCGGCTCA
AGTGGGGACGCCACGTGCGGAGGGACCTGTTCAAGGACCGAAGACACTCGTGGCACGACTGGAGGTTTATGGCAATTCGACCTCGGAG
CCATCGTCAAGGAGGACGGTCTACCCGGAGGGTTGCCCGGGAGGAGGGGAGGAACGTGGCCGGGAAGGACCAGAAACTTATTTCAGAC
TCACCCGCCG


TAC = Start codon

The two strands of DNA are said to be complementary.[39] This is achieved by the manner in which the nucleotide bases pair up. Adenine is always found opposite thymine and guanine always pairs with cytosine, thus A-T, G-C. So a short segment of DNA of sequence ATGCTTCAAG (read from left to right) would pair with a complementary strand of sequence TACGAAGTTC.[39]

The human genome contains over three billion bases and codes for approx 23,000 proteins.[39] Sequencing of the entire human genome was completed in 2003 and provides the reference used by scientists. Only about two per cent of our DNA codes for proteins, while the remainder called non-coding DNA has important functions such as the regulation of gene expression.[39]

Conversion of DNA to protein involves two processes: Transcription and translation (Figure 6).

Transcription involves the production of messenger RNA (mRNA) from the DNA (Figure 4). The double stranded DNA is first separated by the DNA helicase enzyme to expose single strands.[77] The bases on one strand of the DNA are read and mRNA is produced using an enzyme called RNA polymerase. Messenger RNA also has linear configuration similar to that of the DNA. The mRNA is made up of sequential nucleotide bases – adenine, cytosine, guanine and uracil. The thymine of the DNA is replaced with uracil (U) in mRNA. The mRNA moves to the cytoplasm of the cell. The bases of the mRNA pair with the bases of DNA, thus: A with U and G with C.[77]

Figure 4: Transcription

Translation occurs on ribosomes in the cytoplasm of the cell. The strand of mRNA is read much like a data ticker tape and according to sequences of the bases A, C, G and U.[77] Individual amino acids are incorporated into the polypeptide chain. The amino acid components of the proteins are attached to transfer RNAs. Different amino acids are incorporated into the polypetide chain by matching the three bases on the tRNA to a complementary set of three bases in the mRNA. Thus the mRNA functions as a ticker tape which is read in frames each of three bases (Figures 5, 6).[77]

Figure 5: Transcription and translation produces a functional protein

The 20 amino acids are coded for by 64 codons[25] (Table 1). Because there are duplications the code is said to exhibit redundancy which means that some codons can be damaged to some extent without changing the meaning of the code. This helps to make the code more secure against damage.

Translation starts with the first AUG, called a start codon, which signals the first amino acid in the protein. Protein synthesis stops when a stop codon (UAA, UAG or UGA) occurs in the mRNA.

An animated illustration of translation of mRNA is available at http://www.en.wikipedia.org/wiki/File:Translation.gif.

Table 1: Sixty four codons and the amino acid each codes for

Sequential triplets of the ATGC bases in the DNA therefore determine the positions of the individual amino acids present in the protein coded for by a given gene. Deletion of – or a change in - just one base in a DNA sequence can have an impact on the normal function of the protein. Similarly, a deletion of just one DNA base early in the sequence coding for a particular protein will change the triplet code and result in a protein of entirely different amino acid sequence and unable to function as it should.

The polypeptide produced by the ribosome will assume its correct three dimensional configuration based primarily on its amino acid sequence (Figure 6).[36] The correct 3D structure of the protein is essential to its function. While some proteins remain within particular structures in the cell (for example, mitochondrial proteins), others are secreted from the cell and perform their functions in specific fluids, tissues or organs (for example, lysozyme in tears, digestive enzymes from cells in the pancreas in the intestine or insulin in the blood).[36]

Figure 6: Translation of mRNA by ribosomes produces a protein (inset from Figure 5)

Methylation of DNA is performed by three enzymes and results in a chemical modification of the DNA. However, the sequence of the bases present in the DNA is not changed. Methylation determines whether a gene is switched on or off. Methylated DNA can be passed on to the offspring of the parent and will determine gene activation in them.

A DNA sequence can be changed by substitution, insertion or deletion of a DNA base(s).[95] Because the DNA is read in codons three bases long, such insertions or deletions can alter the gene so that its message is read incorrectly. Such changes are called frameshifts.

A substitution simply exchanges one base for another. For example, an A may be changed to a G. This could change a codon and:

~ cause a small change (maybe involving only one amino acid in the protein product); or

~ change the codon to a different one which codes for the same amino acid. This would not cause any change in the produced protein. Such changes are termed silent mutations; or

~ change a codon coding for an amino acid to a single “stop” codon. This would then result in an incomplete or truncated protein. Such a change can be serious as the shortened protein probably would be non-functional.

Insertions occur when extra base pairs are inserted into a new location in the DNA. Thus, the sequence ATGGCA could be changed to ATGGTTGCA by insertion of the three bases as underlined.

Deletions occur when a section of DNA is lost. Thus, the sequence ATTGGCA could be changed to ATGCA by deletion of the two bases as underlined.

A frameshift occurs when sets of three bases which make a codon are read in an incorrect sequence. The sentence:

~ the fat cat and dog sat -

helps to explain the effect of a frameshift. Each word represents a codon. If the first letter is deleted and the sentence reduced to its component sequential blocks of three letters the sentence then reads:

~ ef atc ata ndd ogs at -

The altered sentence does not make sense. Similarly, a frameshift involving DNA will generate entirely different sets of codons, usually resulting in truncated proteins which are non-functional.[95]

Mutations may also occur through other processes. Thus exposure to ultraviolet light causes adjacent thymine bases to link together forming a dimer. The dimerisation distorts the DNA and prevents it being read/processed correctly.

Mutations may arise when mistakes are made when a cell copies its DNA prior to cell division. DNA replication begins with a protein called DNA helicase, which separates the DNA molecule into two strands. A protein called DNA polymerase copies each strand of DNA, creating two double-stranded DNA molecules.[50] Mutations result when the DNA polymerase makes a mistake, which occurs about once every 100,000,000 bases. The actual number of mistakes that remain incorporated into the DNA is much lower than this because cells contain special DNA repair proteins that fix many of the mistakes in the DNA caused by mutagens. The repair proteins see which nucleotides are paired incorrectly and change the wrong base to the right one.[50]

The development of cancer can result when this identification of mutation is not recognised and corrected.[50]

History of epigenetics

Wolf Reik has shown that a change in the environment is enough to switch a gene on or off and this effect is then inherited in subsequent offspring.[69] Reik has demonstrated that genes in mice can be altered and the effects are inherited in more than one subsequent generations of mice. He showed that a single event can change the way genes worked and that this effect is inherited. In this way the memory of an event is passed on to subsequent generations.[69] He wondered if this could prove that what people experienced can affect them, their children and grandchildren. If so, the scientific implications would indeed be profound.

Marcus Pembrey wondered why links between generations would exist. He speculated on the purpose of genes carrying a memory from one generation to the next. Perhaps a message from a mother in one generation to her baby in the next generation might be required. In the case of the mother starving, the growth of the unborn baby’s head would need to be slowed. This message would instruct the growth genes of the baby to work less preventing the baby’s head growing too large to fit through the mother’s pelvis. This would involve co-ordination between two generations.

Pembrey published his speculations in a journal but had no data to support his hypothesis. Four years later he received an email from Olov Bygren in Sweden about studies on a population living in an isolated town in northern Sweden. Överkalix was a unique town as they had extensively documented their isolation, their births and deaths and their harvests. Being so isolated meant that they were vulnerable to famine as they could receive no outside help. They documented their poor harvests and subsequent hard times and also their good harvests and corresponding good times. There were links between their genes.[69]

Bygren subsequently sent Pembrey an email announcing that data existed to support Pembrey’s hypothesis. Thus began an amazing collaboration that would prove that the effects in one generation would affect another decades later.[69]

Meanwhile, scientists such as Rachel Yehuda were studying the response to stress and the transgenerational effects. Yehuda established a treatment clinic for survivors of the holocaust. While treating the survivors for stress many children of survivors were calling and claiming that they too were suffering the effects of stress.[69] Five children of holocaust survivors were calling for every survivor of the holocaust claiming they were casualties of the holocaust too because they were affected indirectly. Yehuda assumed that the stress in the children must be as a result of the years and years of the parents’ storytelling and the children hearing of the stress.[69]

In Edinburgh, Jonathan Seckl was examining stress experienced by pregnant women to see if the effects were transmitted to their offspring. He wondered whether pregnant rats affected by stress would transmit the effect to their offspring. He tested the genes over three generations and found that the third generation had a propensity for an abnormal stress response.[69] He concluded that a stressful event could throw a switch on a gene which was then inherited.[69]

His research may have stopped there. Then the planes crashed into the world trade centre (WTC) twin towers on September 11, 2001 (aka 911). Yehuda and Seckl were both well aware that it would have an impact on future generations. Yehuda and Seckl teamed up to study pregnant women. They studied pregnant women, examining the effects of 911 on babies exposed while in utero. When exposed to a stressful event a person produces cortisol, a hormone that helps regulate the body’s response to that stress.[69] Low cortisol levels indicated a pregnant woman was having difficulty coping, leaving her prone to post traumatic stress disorder (PTSD).[69] They wondered whether the effects could be transmitted to the offspring.

Yehuda and Seckl studied 200 pregnant women in all and approximately half developed PTSD with abnormal levels of cortisol.[69] Their babies also had abnormal levels of cortisol, even though they were not exposed to the original event.[69] This challenged their previous belief that the children of holocaust survivors had abnormal levels of stress hormones because of the stories repeatedly told. That could not be the case in 911 babies as they were only one year old.

Their cortisol levels differed depending on the duration of the pregnancy relative to the time when the WTC collapsed. A more prominent effect was seen in women with PTSD who were pregnant in their third trimester.[69] Yehuda knew then that this was more than genetics at work - something was being transmitted.[69] It seemed that epigenetics could explain the results as an event had altered the stress response in the children.[69] Yehuda wanted to be sure that the hormone levels weren’t caused by the stress levels while the baby was in utero.

So while animal research suggested that the effects of an event persisted into the next generation, speculation hence arose that if the same effects were found in the children of the children of 911 it would prove that the genetic memory of a stressful event can be transmitted through the generations. Yehuda and Seckl speculated on the epigenetic effects of a traumatic event but they needed data that extended beyond one generation. That data now existed.

Pembrey and Bygren studied the effect of famine through the generations. When Bygren considered whether poor nutrition had an effect on the health of subsequent generations he made an exciting discovery. Famine could affect descendents almost 100 years later even though they’d never suffered famine themselves.[69] Bygren considered the evidence suggesting that the food supply of ancestors in Överkalix could affect the mortality rate of their grandchildren. There was documented evidence of diabetes which suggested that epigenetics was involved. Clear links were discovered in the data between the diet of the grandparent and the life expectancy of the grandchild. It seemed that Bygren’s data held the key to epigenetic inheritance in people.[69]

What these scientists now had to explain was how the gene captured this information so that it affected the grandchildren. They needed to uncover the trigger that led to the transgenerational response.

The collaboration between Pembrey and Bygren led to the discovery that there was a specific timeframe within a person’s life when they had an increased sensitivity to environmental information being imprinted on their egg or sperm at the time of formation.[69] The environmental effect was evident. When the eggs and sperm were formed the diet in one generation affected the life expectancy of another.

A study in diabetes by Jimenez–Chillaron et al. in November 2007 investigated whether low birth weight is associated with increased risk of obesity, diabetes and cardiovascular disease during adult life.[57] These scientists wondered whether such disease risks might be passed on to future generations. They starved pregnant mice late in pregnancy to breed animals of low birth weight. These mice of low birth weight were mated together and their offspring were compared to the offspring from parents of normal birth weight. The results indicated that starving pregnant mothers “programs” a low birth weight in her infants and the next generation too. Males from the first-generation crosses were found to be glucose intolerant, increasingly with age. All subsequent generation mice developed glucose intolerance by the age of four months, similar to the mice shown in Figure 7, which shows a stress response inherited by most offspring.[57]

Figure 7: Epigenetics: inherited modification of gene

Mike Skinner, PhD and professor of molecular biosciences, wanted to know what could cause a transgenerational effect. He believed that there was more to the development of new diseases than just genetics. He considered the possibility of the introduction of pesticides coinciding with the development of breast cancer, skin cancer, prostate cancer, immune dysfunction and kidney disease. Skinner has shown that the environmental toxin doesn’t just affect an exposed individual. It also affects people three generations on.[69]

Skinner knew of epigenetics’ role in gene silencing. Discovering that epigenetics played a major role in disease development was unexpected.[69] Exposure to a single chemical affects the genes of offspring across multiple generations. Skinner discovered that the effects of toxins a mother was exposed to while her baby was in utero were passed on to the baby who then passes it on to her children.[69]

Older generations may have survived the depression, war, holocaust or famine and their DNA may have been affected by what they experienced.[66] Lifestyle choices also impact a person’s health and well-being and that of their descendents.[66]

These epigeneticists are changing the way many scientists think about inheritance. Pembrey and Bygren have shown that the lives of parents, grandparents and great-grandparents greatly affect their descendants’ wellbeing even when they lack personal experience of any of these events themselves.[69]

Epigenetics of diet

In summary, there are several epigenetic ways in which gene activity can be prevented or controlled, including modification of histone proteins, DNA methylation and RNA interference. For any of these methods of gene regulation, the absence of the protein product of the gene causes a change in the function or development of the cell.[64]

Since discovering the intriguing world of epigenetics I have wondered how informative it might be to have given samples of my blood at various times throughout my life when I was experiencing health problems. If these specimens had been stored in a laboratory somewhere I would gladly donate other samples now that my health is so much improved. It would be fascinating, I think, to have these samples tested together to detect differences in methylation patterns in the samples. The geneticists might suggest other tests to determine the on/off status of stress response genes. The results obtained from the testing would likely be considered indicative rather than representative because of the small sample size (only 1!). Obviously, such studies would provide more reliable data if a proper trial was conducted with a larger number of participants and including appropriate control groups. That said, at this point in time there is no way I’d willingly change my diet and risk more episodes of the ailments and adverse symptoms detailed in Chapter 4 (My Health History) so that appropriate blood samples could be collected and tested to demonstrate epigenetic differences. The price I’d pay would be more than I would choose to pay.

This book looks at common imbalances that result from a modern western diet and how to correct them. Lifestyle choices made impact a person in many ways, affecting not only body shape. A person’s health is a complicated function of genes, what they eat, what happens in their daily lives and the physiological and psychological reactions to all of these factors.

Conclusion

Epigenetics is the study of the environment causing genes to be switched on or off and this effect being inherited in subsequent generations. Existing research has investigated stressful events, the response to that stress and its heritability. This includes the stress that results from insufficient food, different types of foods, too much food and nutritionally poor foods. The evidence available comes from the invention of a multitude of diseases that modern humans have developed since the introduction of agriculture.[51]

Considerable research activity is currently in progress with the aim of clarifying the links between diet, epigenetics and disease by identifying components of the western diets which cause disease and explaining the mechanisms by which health problems and diseases arise. In-depth discussion of the methods and findings to date are beyond the scope of this book. Thus, epigenetics may provide answers to fundamental questions such as: “Why is the majority of the population now overfat?”; “Why can’t I eat what (s)he eats and not put on fat?” and “What’s wrong with me today?”

Meanwhile, until these links are identified, the best advice seems to be that we should eat lots of green vegetables, limit our alcohol intake and eat liver! Liver is recommended because it is rich in choline and vitamin B12.[34]

Summary

This chapter shows how epigenetics is revealing the hidden influences upon genes that could affect every aspect of our lives. Epigenetics, meaning “added on to the genes” is the study of the environment causing genes to be switched on or off and this effect being inherited. It indicates that what parents, grandparents and even great-grandparents experienced (not necessarily by choice) affects their offspring’s health.[70]

Epigenetics bridges the gap between nature and nurture.

People’s genes are shaped in part by their ancestors' life experiences. May this encourage everyone to leave a positive legacy to their children and grandchildren.

* * *





Glossary

* * *





References

This is the complete list of References from The Epigenetics of Diet eBook.

1 A 2 Z of Health, Beauty and Fitness, Mental Illness linked to Modern Diet, http://www.health.learninginfo.org/mental-illness-modern-diet.htm, 1 June 2010.

2 A Basic Introduction to the Science Underlying NCBI Resources, Molecular Genetics: Piecing It Together, http://www.ncbi.nlm.nih.gov/About/primer/genetics_molecular.html, 1 June 2010.

3 About.com: Biology, Digestive System Anatomy, http://www.biology.about.com/library/organs/bldigestoverview2.htm, 1 May 2010.

4 Acquaah, G., Pesticide Use in U.S. Crop Production, Principles of Crop Production, Theories, Techniques and Technology, Prentice Hall, 2002.

5 Adams, Mike, Virtually All Modern Disease Is Caused By "Metabolic Disruptors" Found In Everyday Foods And Groceries, http://www.truthpublishing.com/grocerywarning_p/yprint-cat21246.htm, 1 May 2009.

6 Andrews, Dr Sam S, Dr Luis A Balart, Dr Morrison C Bethea & H Leighton Steward, Sugar Busters, Ballantine Books, 1998; cited in Nexus, 1999.

7 Aronson, Tara, Wake Up, Sleepy Teens! http://www.parent-teen.com/yourbody/sleep.html, 1997.

8 Aston, Donna, Body Business, Viking, 2001.

9 Aston, Donna, Fat or Fiction, Hybrid Publishers, 2000.

10 Atha, Antony, The Ultimate Herb Book, Collins & Brown, 2001.

11 Australian Bureau of Statistics, How Australians Measure Up, http://www.measureup.gov.au/internet/abhi/publishing.nsf, 2010.

12 Basics of the Cardiovascular System, http://www.ehow.com/about_5097433_basics-cardiovascular-system.html, 1 May 2010.

13 Becker, ES, J. Margraf, V. Türke, U. Soeder, S. Neumer, Obesity and mental illness in a representative sample of young women, http://www.ncbi.nlm.nih.gov/pubmed/11466578, 2001.

14 Bellwood, Peter. First Farmers: The Origins of Agricultural Societies, Blackwell Publishing, 2004.

15 Berkson, D. Lindsey, Natural Remedies for GI Complaints, http://www.findarticles.com/p/articles/mi_m0ISW/is_2001_June/ai_75178721/, 1 May 2010.

16 Brady, N.C. and R.R. Weil, Elements of the Nature and Properties of Soils, Prentice Hall, 2002.

17 Brand Miller, Dr Jennie & Kaye Foster Powell, The G.I. Factor, Hodder, 2000.

18 Carskadon, Mary A., Patterns of sleep and sleepiness in adolescents, http://www.sleepforscience.org, 1990.

19 Carson-DeWitt, Rosalyn, Answers.com, http://www.answers.com/topic/obesity, 1 May 2010.

20 Chaitow, Dr Leon & Dr Angelina Di Fazio, The Body/Mind Purification Program, Simon & Schuster Inc., 1990.

21 Chaitow, Dr Leon, Candida albicans: Could Yeast be your problem?, Harper Collins Publishers Limited, 1996.

22 Chapman, Jeff, The Impact of the Potato, History Magazine. http://w ww.history-magazine.com/potato.html, 1 May 2010.

23 Choice, Food additives you should avoid, http://www.choice.com.au/Reviews-and-Tests/Food-and-Health/Food-and-drink/Safety/Food-additives/Page.aspx#01, 1 May 2010.

24 Colagiuri, Stephen, article in The Medical Journal of Australia; cited in The Herald Sun, http://www.heraldsun.com.au/news/obesity-costs-australian-taxpayers-dearly/story-e6frf7jo-1225835388830, 1 March 2010.

25 Columbia University, Sixty four codons and the amino acid each codes for, http://www.columbia.edu/cu/biology/courses/c2005/images/gencode.html, 1 May 2010.

26 Crisis Support. Following the References section, the Additional Resources section includes Crisis Support. Contact details are provided for organisations offering help and support for those in need.

27 D’Adamo, Dr. Peter, Eat Right for Your Type Diet, Century Books Limited, 1996.

28 Davidson College, Department of Biology, Davidson NC 28036, The Hemoglobing Mutagenesis Page, http://www.bio.davidson.edu/courses/Bio111/Hemomut.html, 1 May 2010.

29 Diabetes Australia, http://www.diabetes.com.au, 2002.

30 Dingle, Dr Peter. My Dog Eats Better Than Your Kids ... and what you can do to change this, Dingle Presentations, 2008.

31 Dufty, William, Sugar Blues, Chilton Book Co., 1975.

32 Eades, Dr Michael R, & Dr Mary Dan Eades, Protein Power, Bantam Books, 1996.

33 Encyclopædia Britannica Australia, http://www.britannica.com.au/britannica_browse/b/b86.html, 1 May 2010.

34 Epigenome Network of Excellence, Eating for your genome. http://www.epigenome.eu/en/2,48,875, 29 May 2010.

35 Family Circle, The Fat, Fibre and Carbohydrate Counter, Murdoch Books, 2007.

36 File:Proteinsynthesis.png, http://www.en.wikipedia.org/wiki/File:Proteinsynthesis.png, 1 June 2010.

37 Flynn, James Robert, What is Intelligence: Beyond the Flynn Effect, Cambridge University Press, 2007.

38 Gabriel, Jon, The Gabriel Method, Beyond Words Pub., 2007.

39 Genes and ‘junk’, Wellcome Trust Sanger Institute’s yourgenome.org, http://www.yourgenome.org/dgg/general/genes/genes_1.shtml, 1 June 2010.

40 Health Insite – An Australian Government Initiative, Diet and Conditions, http://www.healthinsite.gov.au/topics/Diet_and_Conditions, 2009.

41 Heller, Dr. Rachael F. & Dr. Richard F. Heller, The Carbohydrate Addicts’ Diet, Signet, 1993.

42 Hunter-gatherer, http://www.en.wikipedia.org/wiki/Hunter-gatherer, 1 June 2010.

43 Imugene Limited (Advanced Vaccine Technologies), http://www.imugene.com/products_markets.asp, 1 May 2010.

44 Inglewood Farms – Organic Chicken Products, http://www.inglewoodfarms.com/chicken.html, 1 May 2010.

45 Joffe, Evelynne, The Complete Australian Kilojoule, Calorie & Carbohydrate Counter, Simon & Schuster Australia Pty Limited, 1987.

46 Joseph, Robert F., The Chocolate Lovers’ Diet, Noble Porter Press, 1995.

47 Kelly, Peter, Healthy Eating Pyramid, http://www.peterkelly.com.au/foodpyramid.htm, 2009.

48 Kenton, Leslie & Susannah Kenton, Raw Energy, Century Arrow, 1984.

49 Larmer, Christina, 10 Health Risks for Women, The Sunday Mail, News Corporation, 21 March 2010.

50 Learn Genetics, http://learn.genetics.utah.edu/archive/sloozeworm/mutationbg, 1 June 2010.

51 Lindeberg, Staffan. Food and Western Disease: Health and Nutrition from an Evolutionary Perspective, Wiley-Blackwell, 2010.

52 Linn, Denise, Past Lives, Present Dreams, Ballantine Books, 1994.

53 Lungs and Respiratory system, A Body Basics Article, http://www.kidshealth.org/parent/asthma_basics/lungs/lungs.html, 1 May 2010.

54 Magendie, Professor Francois, 1816; cited in Andrews, Dr Sam S, Dr Luis A Balart, Dr Morrison C Bethea & H Leighton Steward, Sugar Busters, Ballantine Books, 1998.

55 Maize Streak Virus-Resistant Transgenic Maize: an African solution to an African Problem, http://www.scitizen.com, August 7, 2007.

56 McCollum, Dr. E. V., A History of Nutrition, Houghton Mifflin Company, 1958.

57 McVittie, Brona. Dining for your descendants, http://www.epigenome.eu/en/1,63,0, 2008.

58 Mehta, Mira, Yoga, Sebastian Kelly, 1999.

59 Middle Ages, http://www.en.wikipedia.org/wiki/Middle_Ages, 1 June 2010.

60 Neolithic Revolution, http://www.en.wikipedia.org/wiki/Neolithic_Revolution, 1 June 2010.

61 New South Wales HSC Online, Charles Sturt University, http://www.hsc.csu.edu.au/senior_science/options/pres_add/2909/index.html, 1 May 2010.

62 Northrup, Dr Christiane, The Oprah Show, 2002.

63 Nothlings, Ute, University of Hawaii, 2005; cited in Adams, 2009.

64 Nova Science in the news, Epigenetics – beyond genes, http://www.science.org.au/nova/098/098key.htm, 29 May 2010.

65 O’Brien, Ken, The Heritability of Post Traumatic Stress Disorder in the Children and Grandchildren of Vietnam veterans (PhD thesis), 2009.

66 O’Brien, Ken, The intergenerational transference of Post-Traumatic Stress Disorder amongst children and grandchildren of Vietnam veterans in Australia: An argument for a genetic origin. Review of current literature, http://eprints.qut.edu.au/650, 2004.

67 Organic Federation of Australia, Chairs Report, http://www.ofa.org.au, 1 June 2005.

68 Paleolithic, http://www.en.wikipedia.org/wiki/Paleolithic, 1 June 2010.

69 Paterson, N. (Writer) (2006). Ghost in the Genes [Documentary]. N. Paterson (Producer), Horizon. Australia: SBS Television, 2010.

70 Paterson, N. (Writer) (2006). Ghost in the Genes [Documentary]. N. Paterson (Producer), Horizon. Australia: SBS Television, 2010; cited in O’Brien, Ken, 200965.

71 Phillips, Bill & Michael D’Orso, Body for Life, HarperCollins Publishers, 1999.

72 Portelli, Michael, Chiropractor, Spineline, 2001. (http://www.spineline.com.au)

73 Preston-Martin, S. et al. N-nitroso compounds and childhood brain tumors: A case-control study, Cancer Res. 1982; cited in Adams, 2009.

74 Price, Dr Weston A., Nutrition and Physical Degeneration: A Comparison of Primitive and Modern Diets and Their Effects, Price-Pottenger Foundation, 1939.

75 Price, T. Douglas, Europe's first farmers, Cambridge University Press, 2000.

76 ProActive Health, Questionable Food Additives Article, http://www.proactivehealth.net.au/index.php?mp_id=9, 1 May 2010.

77 Protein Synthesis: Transcription and Translation, http://faculty.clintoncc.suny.edu/faculty/michael.gregory/files/bio%20101/bio%20101%20lectures/protein%20synthesis/protein.htm, 01 July 2010.

78 Raglin, JS, Exercise and mental health: Beneficial and detrimental effects, http://www.ncbi.nlm.nih.gov/pubmed/2192422, 1990.

79 Sunday program, Channel Nine, 2002.

80 Starch Digestion: Traveling Through the Gut, Oracle ThinkQuest Education Foundation, http://library.thinkquest.org/11226/main/c03txt.htm, 01 July 2010.

81 The Age, Australia's Future 'Fat Bomb' article, Fairfax, 2008.

82 The Courier Mail (Queensland Newspaper), News Limited, 2002.

83 The Facts about chicken, A Dietitian’s Guide http://www.chicken.org.au/gpnutrition/CPD%20for%20GPNutrition/Dietitian%20Guide.pdf, 1 May 2010.

84 The Free Dictionary, http://www.thefreedictionary.com, 1 June 2010.

85 The Heart Foundation; cited in Larmer, Christina, 10 Health Risks for Women, The Sunday Mail, News Corporation, 21 March 2010.

86 The Melbourne Food Ingredient Depot, http://www.mfcd.net/depot/PROD/sodnit.asp, 1 May 2009.

87 The Ohio State University, Super-Sized Cassava Plants May Help Fight Hunger In Africa, http://www.researchnews.osu.edu/archive/suprtubr.htm, 1 June 2010.

88 The Royal Australian College of General Practitioners (RACGP), Excessive weight gain, http://www.racgp.org.au/familyhealth/Excessive_weight_gain_child, 2009.

89 Three Age System, http://www.en.wikipedia.org/wiki/Three-age_system, 1 June 2010.

90 Tilman, D, KG Cassman, PA Matson, R Naylor, S Polasky, Agricultural sustainability and intensive production practices, Nature, August 2002.

91 Time Magazine, Summary of an article published in a 1958 edition of Time Magazine, Time Warner, 2002.

92 Timperio, Cameron-Smith, Burns & Crawford, The public's response to the obesity epidemic in Australia: weight concerns and weight control practices of men and women, http://www.journals.cambridge.org/action/displayAbstract?fromPage=online&aid=556208, 2007.

93 Toth, Nicholas and Kathy Schick, Handbook of Paleoanthropology, Springer Berlin Heidelberg, 2007.

94 U.S. National Library of Medicine, Kitava Study publications, PubMed.gov, http://www.ncbi.nlm.nih.gov/pubmed?term=Kitava+AND+%22Lindeberg+S%22, 1 May 2010.

95 University of California Museum of Paleontology, Types of Mutations, Understanding Evolution, http://www.evolution.berkeley.edu/evolibrary/article/0_0_0/mutations_03, 29 May 2010.

96 Vartabedian, Dr Roy E & Kathy Matthews, Nutripoints, HarperPaperbacks, 1990.

97 Vasey, Christopher & Jon Graham, The Acid-Alkaline Diet for Optimum Health: Restore Your Health by Creating pH Balance in Your Diet, Inner Traditions / Bear & Company, 2006.

98 Vitaco, http://www.vitaco.com.au, 1 May 2010.

99 Voegtlin, Walter L., The stone age diet: Based on in-depth studies of human ecology and the diet of man. Vantage Press, 1975.



* * *





Recommended Reading

If this book resulted in an increased awareness about how events and diet effect our emotions, bodies and behaviour and you would like to know more, the following book is recommended.

The Epigenetics of Diet

This is not a typical "diet" book. It is THE book of preventative medicine.

The Epigenetics of Diet explains how our food and environment affect our emotions, bodies and behaviour and trigger genetic switches (which determine the diseases we get and affect our children). It explains the evolution of the modern western diet and its dire consequences. Learn how to use food to turn on desirable genetic switches and turn others off (diabetes, cancer, obesity). Do it for yourself - and do it for your family.

Discover the truth about what commonly recommended and popular foods really do to the human body. Like no other, this book teaches you how to eat foods that fuel the body (Phase 1) to correct the 3 common imbalances that lead to excess body fat enabling you to obtain and maintain optimal health, weight and body shape for life (Phase 3). Learn how to test all other foods to find those that you can eat without adverse reactions, including weight gain, mood swings, depression, headache, lethargy, irritable bowel syndrome and the list goes on and on and on... (Phase 2). Obesity, diabetes, cancer and many other diseases, conditions and symptoms are preventable by eating truly nutritious foods. Learn how to test all other foods to find those that *you* can eat without adverse reactions. Discover *your diet*.

It is part text book, part training manual and part self-help book. It is simply a book like no other.

(The Epigenetics of Diet is the first in "The Epigenetics of..." series. Other titles are due for release in 2011.)

The Author

Web: http://epigenetics.cc

This website provides more information about the author, epigenetics and other books in “The Epigenetics Of...” series.

Email: diet at epigenetics dot cc



* * *





A note from the author

Thank you for reading my book (or ~ rather ~ a chapter of it)! I trust it resulted in an increased awareness and discussion about events and their effects on our emotions, bodies and behaviour. I hope that it empowers you to read The Epigenetics of Diet in its entirety.

If you did not read this book for the sole purpose of learning how to improve your own health, but because you are a health practitioner wanting up-to-date information on nutrition, then it is strongly recommended that you download, read, understand and apply The Epigenetics of Diet to your life, your patients and your practice.

The Epigenetics of...

Additional titles in "The Epigenetics of" series are planned and are due for release in 2011.

Epigenetics is a fascinating science that bridges the gap between nature and nurture. I look forward to writing and publishing further books in this series. I am co-author on subsequent titles with Ken O'Brien, who so graciously wrote the preface to The Epigenetics of Diet.

For the latest information, visit http://epigenetics.cc

Or join me on Facebook: The Epigenetics of Diet Book and Lifestyle Epigenetics.

Thank you for taking this journey with me. I wish you all the very best with your journey to ongoing good health.

Janine Schott

1 March 2011

22


Download this book for your ebook reader.
(Pages 1-29 show above.)